Human Beta-globin PCR Primer Set (PCR Control)

Takara’s Humand Beta-globin Control Primer Set can be used as a positive experimental control, for example during PCR amplifications. The set contains several PCR primers which are able to recognize the human beta-globin gene at chromosome 11.

Primer Sequences
PC03 (forward) d(ACACAACTGTGTTCACTAGC)
PC04 (reverse) d(CAACTTCATCCACGTTCACC)

GH20 (forward) d(GAAGAGCCAAGGACAGGTAC)
GH21 (reverse) d(GGAAAATAGACCAATAGGCAG)

KM29 (forward) d(GGTTGGCCAATCTACTCCCAGG)
KM38 (reverse) d(TGGTCTCCTTAAACCTGTCTTG)

Ordering information

Westburg offers this product in The Netherlands, Belgium, Luxembourg,
If you are not located in these countries please visit the Takara website to find your local distributor.
Cat no. Description
TB 3868 Beta-globin(human)primerSet, 500pmol x6